Ref: Gibbons,H.S. et al. unpublished

REBASE ref # 12106

GenBank #: AEFW00000000

REBASE acronym: Bat498222

Org_num: 6957

 

All begin

Type II
ORF Gene Most similar Specificity Name
 
??? C C.Bsu1246ORF146P (100% identity) ACTTATAGTCCGTGGACACATAGT C.Bat498222ORFBP
??? R Bsu1246ORF146P (100% identity) AGATCT Bat498222ORFBP
??? M M.Bsu1246ORF146P (96% identity) AGATCT M.Bat498222ORFBP
 
??? M M.Bsu1246ORF130P (100% identity) GCCNNNNNGGC M.Bat498222ORFCP
??? R Bat49822ORFCP (100% identity) GCCNNNNNGGC Bat498222ORFCP
Type IV
ORF Gene Most similar Specificity Name
 
??? R BatDORFCP (100% identity) Bat498222ORFAP
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.