Ref: Geng,W. et al. unpublished

REBASE ref # 12928

Complete sequence: 3,995,227 bp

GenBank #: CP002634

REBASE acronym: BamLL3

Org_num: 6929

 

All begin LL3_

Type II
ORF Gene Most similar Specificity Name
 
601 65 aa hypothetical protein
602 M M.BveZY1ORF13730P (100% identity) M.BamLL3ORF602P
603 107 aa hypothetical protein
 
2261 Modification methylase Rho11sI
2262 M M.BcoB425ORF1800P (100% identity) CAGCTG M.BamLL3ORF2262P
2263 SPBc2 prophage-derived
 
3373 804 aa hypothetical protein
3374 M M.Bam6ORF22610P (100% identity) M.BamLL3ORF3374P
3375 DNA-dependent DNA polymerase, family A
 
3410 multidrug-efflux transporter
3411 R Bsu13952ORF16390P (100% identity) GGATCC BamLL3ORF3413P
3412 BamHI control element
3413 M M.Bsu13952ORF16390P (100% identity) GGATCC M.BamLL3ORF3413P
3414 81 aa hypothetical protein
 
3411 Type-2 restriction enzyme BamHI
3412 C C.Bsu13952ORF16390P (100% identity) ACTTATAGTCTGTAGCCTATAGTC C.BamLL3ORF3412P
3413 Modification methylase BamHI; M.BamHI; N
 
4072 phosphotransferase system (PTS)
4073 V V.Bsu13952ORF19190P (100% identity) V.BamLL3ORF4074P
4074 M M.BcoB425ORF3140P (100% identity) GCWGC M.BamLL3ORF4074P
4075 ATP-binding protein
Orphan M
ORF Gene Most similar Specificity Name
 
2260 SPBc2 prophage-derived uncharacterized protein
2261 M M1.BsuH1716ORF11275P (96% identity) GGCC M.BamLL3ORF2261P
2262 DNA modification methylase
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.