Ref: Zhang,G. et al. unpublished

REBASE ref # 12803

Complete sequence: 3,937,511 bp

GenBank #: CP002627

REBASE acronym: BamTA208

Org_num: 6879

 

All begin BAMTA208_

Type II
ORF Gene Most similar Specificity Name
 
6520 130 aa hypothetical protein
6525 M M.BveSCGB1ORF33P (100% identity) GGATCC M.BamTA208ORF6525P
6530 71 aa hypothetical protein
 
16645 multidrug-efflux transporter
16650 R Bsu13952ORF16390P (100% identity) GGATCC BamTA208IP
16655 C C.Bsu13952ORF16390P (100% identity) ACTTATAGTCTGTAGCCTATAGTC C.BamTA208IP
16660 M M.Bsu13952ORF16390P (100% identity) GGATCC M.BamTA208I
16665 81 aa hypothetical protein
 
19825 phosphotransferase system (PTS)
19830 V V.Bsu13952ORF19190P (100% identity) V.BamTA208IIP
19835 M M.Bsu13952ORF19190P (100% identity) GCWGC M.BamTA208II
19840 ATP-binding protein
Orphan M
ORF Gene Most similar Specificity Name
 
6710 80 aa hypothetical protein
6715 M M.Bsu13952ORF10440P (100% identity) GGCC M.BamTA208ORF6715P
6720 nucleic acid binding protein; phage SPbeta
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.