Ref: Kaneko,T. et al. DNA Res. 8 (5), 205-213 (2001)

REBASE ref # 7469

Sequence length:GenBank #:
chromosome: 6,413,771 bp BA000019 (NC_003272)
plasmid pCC7120alpha: 408,101 bp BA000020 (NC_003276)

REBASE acronym: Ava

Org_num: 155

 

All begin all, alr, asl, asr

Type I
ORF Gene Most similar Specificity Name
 
chromosome
 
498 DegT/DnrJ/EryC1/StrS family
499 M M.Ava27893ORFUP (100% identity) M.AvaORF499P
500 58 aa hypothetical protein
 
508 187 aa hypothetical protein
??? R Ava27893ORFUP (100% identity) AvaORF509P
511 198 aa conserved hypothetical protein
 
2683 transposase
2684 R type I restriction endonuclease AvaORF2688P
2685 PIN domain-containing protein
2686 type II toxin-antitoxin system Phd/YefM family antitoxin
2687 S S.Ava27893ORFPP (100% identity) S.AvaORF2688P
??? M M.Ava27893ORFPP (99% identity) M.AvaORF2688P
2690 54 aa hypothetical protein
 
3472 557 aa hypothetical protein AN481_16600
3473 R Ava27893ORFBP (100% identity) TAAGNNNNNNNGTCA AvaXIP
3474 330 aa conserved hypothetical protein
3475 M M.Ava27893ORFBP (100% identity) TAAGNNNNNNNGTCA M.AvaXI
??? S S.Ava27893ORFBP (100% identity) TAAGNNNNNNNGTCA S.AvaXI
3478 89 aa hypothetical protein
 
3617 105 aa hypothetical protein
3618 R Ava27893ORFNP (100% identity) AvaORF3620P
3619 330 aa conserved hypothetical protein
3620 M M.Ava27893ORFNP (100% identity) M.AvaORF3620P
3621 74 aa hypothetical protein
3622 twitching motility protein PilT
3623 S S1.Ava27893ORFNP (100% identity) S.AvaORF3620AP
3624 transposase
3625 S S2.Ava27893ORFNP (85% identity) S.AvaORF3620BP
3626 123 aa hypothetical protein
 
4596 malic enzyme
4597 M M.Ava27893ORFFP (100% identity) M.AvaORF4597P
4598 87 aa hypothetical protein
4599 DUF820 domain-containing protein
4600 96 aa hypothetical protein
4601 twitching motility protein PilT
4602 S S.Ava27893ORFFP (100% identity) S.AvaORF4597P
4603 173 aa hypothetical protein
??? R Ava27893ORFFP (94% identity) AvaORF4597P
4606 771 aa conserved hypothetical protein
Type II
ORF Gene Most similar Specificity Name
 
chromosome
 
60 Protein of unknown function DUF427
61 M M.Ava27893ORFGP (100% identity) GATC M.AvaVI
62 Protein of unknown function DUF751
 
932 PP-loop
933 R Ava27893ORFHP (100% identity) GGWCC AvaII
934 M M.Ava27893ORFHP (100% identity) GGWCC M.AvaII
935 103 aa conserved hypothetical protein
 
1151 cytochrome B
??? M M.Ava27893ORFIP (100% identity) GGCC M.AvaVII
??? anthranilate phosphoribosyltransferase
 
1289 70 aa conserved hypothetical protein
1290 M M.Ava27893ORFTP (100% identity) SAGCTS M.AvaX
??? cyanate lyase
 
2275 Protein of unknown function DUF820
2276 M M.Ava27893ORFAP (100% identity) CGATCG M.AvaVIII
2277 aldo/keto reductase
 
3630 transposase
??? R Ava27893ORFOP (100% identity) CYCGRG AvaI
??? M M.Ava27893ORFOP (100% identity) CYCGRG M.AvaI
3633 glucanase
 
3699 Chain B, Crystal Structure Of Apo-form Alr3699/hepe From Anabaena Sp. Strain Pcc 7120
3700 M M.Ava27893ORF2370P (28% identity) CTGCAG M.AvaORF3700P
3701 R M.Ava27893ORF2370P (65% identity) CTGCAG AvaORF3700P
3702 D-Ala-D-Ala carboxypeptidase, Metallo peptidase, MEROPS family M15B
 
4172 481 aa conserved hypothetical protein
??? M M.Ava27893ORFDP (100% identity) RCCGGY M.AvaIX
4174 deoxyribose-phosphate aldolase
 
4409 cytochrome c
4410 R Ava27893ORFEP (100% identity) ATGCAT AvaIII
4411 M M.Ava27893ORFEP (100% identity) ATGCAT M.AvaIII
4412 von Willebrand factor, type A
 
4814 162 aa conserved hypothetical protein
4815 M M.Ava27893ORFQP (100% identity) GCTNAGC M.AvaIVP
??? R Ava27893ORFQAP (100% identity) GCTNAGC AvaIVAP
4816 transposase
4817 transposase
4818 R Ava27893ORFQBP (79% identity) GCTNAGC AvaIVBP
4819 118 aa hypothetical protein
 
plasmid pCC7120alpha
 
7269 Protein of unknown function DUF1392
7270 M M.Ava27893ORFLP (100% identity) YGGCCR M.AvaORF7270P
7271 130 aa conserved hypothetical protein
 
7279 DNA-N1-methyladenine dioxygenase
??? M M.Ava27893ORFKP (100% identity) GATC M.AvaV
7281 79 aa hypothetical protein
 
7368 Protein of unknown function DUF1392
7369 M M.Ava27893ORFJP (100% identity) YGGCCR M.AvaORF7369P
7370 ASCH domain-containing protein
Type IV
ORF Gene Most similar Specificity Name
 
plasmid pCC7120alpha
 
7131 137 aa conserved hypothetical protein
7132 R Ava23MrrP (100% identity) AvaMrrP
7133 706 aa conserved hypothetical protein
Homing
ORF Gene Most similar Specificity Name
 
chromosome
 
4034 72 aa hypothetical protein
??? R hypothetical protein GTTGCAGGCAATATCCGGCGTAGTGCCGGAATGCGTCAG PI-AvaI
4036 pyridoxamine 5'-phosphate oxidase-like protein
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.