|
Putative Anabaena variabilis ATCC 27893 RM systems
Ref: Kaneko,T. et al. DNA Res. 8 (5), 205-213 (2001)
REBASE ref # 7469
Sequence length: | GenBank #: | |
chromosome: | 6,413,771 bp | BA000019 (NC_003272) |
plasmid pCC7120alpha: | 408,101 bp | BA000020 (NC_003276) |
REBASE acronym: Ava
Org_num: 155
All begin all, alr, asl, asr
Type I | ||||
---|---|---|---|---|
ORF | Gene | Most similar | Specificity | Name |
chromosome | ||||
498 | DegT/DnrJ/EryC1/StrS family | |||
499 | M | M.Ava27893ORFUP (100% identity) | M.AvaORF499P | |
500 | 58 aa hypothetical protein | |||
508 | 187 aa hypothetical protein | |||
??? | R | Ava27893ORFUP (100% identity) | AvaORF509P | |
511 | 198 aa conserved hypothetical protein | |||
2683 | transposase | |||
2684 | R | type I restriction endonuclease | AvaORF2688P | |
2685 | PIN domain-containing protein | |||
2686 | type II toxin-antitoxin system Phd/YefM family antitoxin | |||
2687 | S | S.Ava27893ORFPP (100% identity) | S.AvaORF2688P | |
??? | M | M.Ava27893ORFPP (99% identity) | M.AvaORF2688P | |
2690 | 54 aa hypothetical protein | |||
3472 | 557 aa hypothetical protein AN481_16600 | |||
3473 | R | Ava27893ORFBP (100% identity) | TAAGNNNNNNNGTCA | AvaXIP |
3474 | 330 aa conserved hypothetical protein | |||
3475 | M | M.Ava27893ORFBP (100% identity) | TAAGNNNNNNNGTCA | M.AvaXI |
??? | S | S.Ava27893ORFBP (100% identity) | TAAGNNNNNNNGTCA | S.AvaXI |
3478 | 89 aa hypothetical protein | |||
3617 | 105 aa hypothetical protein | |||
3618 | R | Ava27893ORFNP (100% identity) | AvaORF3620P | |
3619 | 330 aa conserved hypothetical protein | |||
3620 | M | M.Ava27893ORFNP (100% identity) | M.AvaORF3620P | |
3621 | 74 aa hypothetical protein | |||
3622 | twitching motility protein PilT | |||
3623 | S | S1.Ava27893ORFNP (100% identity) | S.AvaORF3620AP | |
3624 | transposase | |||
3625 | S | S2.Ava27893ORFNP (85% identity) | S.AvaORF3620BP | |
3626 | 123 aa hypothetical protein | |||
4596 | malic enzyme | |||
4597 | M | M.Ava27893ORFFP (100% identity) | M.AvaORF4597P | |
4598 | 87 aa hypothetical protein | |||
4599 | DUF820 domain-containing protein | |||
4600 | 96 aa hypothetical protein | |||
4601 | twitching motility protein PilT | |||
4602 | S | S.Ava27893ORFFP (100% identity) | S.AvaORF4597P | |
4603 | 173 aa hypothetical protein | |||
??? | R | Ava27893ORFFP (94% identity) | AvaORF4597P | |
4606 | 771 aa conserved hypothetical protein | |||
Type II | ||||
ORF | Gene | Most similar | Specificity | Name |
chromosome | ||||
60 | Protein of unknown function DUF427 | |||
61 | M | M.Ava27893ORFGP (100% identity) | GATC | M.AvaVI |
62 | Protein of unknown function DUF751 | |||
932 | PP-loop | |||
933 | R | Ava27893ORFHP (100% identity) | GGWCC | AvaII |
934 | M | M.Ava27893ORFHP (100% identity) | GGWCC | M.AvaII |
935 | 103 aa conserved hypothetical protein | |||
1151 | cytochrome B | |||
??? | M | M.Ava27893ORFIP (100% identity) | GGCC | M.AvaVII |
??? | anthranilate phosphoribosyltransferase | |||
1289 | 70 aa conserved hypothetical protein | |||
1290 | M | M.Ava27893ORFTP (100% identity) | SAGCTS | M.AvaX |
??? | cyanate lyase | |||
2275 | Protein of unknown function DUF820 | |||
2276 | M | M.Ava27893ORFAP (100% identity) | CGATCG | M.AvaVIII |
2277 | aldo/keto reductase | |||
3630 | transposase | |||
??? | R | Ava27893ORFOP (100% identity) | CYCGRG | AvaI |
??? | M | M.Ava27893ORFOP (100% identity) | CYCGRG | M.AvaI |
3633 | glucanase | |||
3699 | Chain B, Crystal Structure Of Apo-form Alr3699/hepe From Anabaena Sp. Strain Pcc 7120 | |||
3700 | M | M.Ava27893ORF2370P (28% identity) | CTGCAG | M.AvaORF3700P |
3701 | R | M.Ava27893ORF2370P (65% identity) | CTGCAG | AvaORF3700P |
3702 | D-Ala-D-Ala carboxypeptidase, Metallo peptidase, MEROPS family M15B | |||
4172 | 481 aa conserved hypothetical protein | |||
??? | M | M.Ava27893ORFDP (100% identity) | RCCGGY | M.AvaIX |
4174 | deoxyribose-phosphate aldolase | |||
4409 | cytochrome c | |||
4410 | R | Ava27893ORFEP (100% identity) | ATGCAT | AvaIII |
4411 | M | M.Ava27893ORFEP (100% identity) | ATGCAT | M.AvaIII |
4412 | von Willebrand factor, type A | |||
4814 | 162 aa conserved hypothetical protein | |||
4815 | M | M.Ava27893ORFQP (100% identity) | GCTNAGC | M.AvaIVP |
??? | R | Ava27893ORFQAP (100% identity) | GCTNAGC | AvaIVAP |
4816 | transposase | |||
4817 | transposase | |||
4818 | R | Ava27893ORFQBP (79% identity) | GCTNAGC | AvaIVBP |
4819 | 118 aa hypothetical protein | |||
plasmid pCC7120alpha | ||||
7269 | Protein of unknown function DUF1392 | |||
7270 | M | M.Ava27893ORFLP (100% identity) | YGGCCR | M.AvaORF7270P |
7271 | 130 aa conserved hypothetical protein | |||
7279 | DNA-N1-methyladenine dioxygenase | |||
??? | M | M.Ava27893ORFKP (100% identity) | GATC | M.AvaV |
7281 | 79 aa hypothetical protein | |||
7368 | Protein of unknown function DUF1392 | |||
7369 | M | M.Ava27893ORFJP (100% identity) | YGGCCR | M.AvaORF7369P |
7370 | ASCH domain-containing protein | |||
Type IV | ||||
ORF | Gene | Most similar | Specificity | Name |
plasmid pCC7120alpha | ||||
7131 | 137 aa conserved hypothetical protein | |||
7132 | R | Ava23MrrP (100% identity) | AvaMrrP | |
7133 | 706 aa conserved hypothetical protein | |||
Homing | ||||
ORF | Gene | Most similar | Specificity | Name |
chromosome | ||||
4034 | 72 aa hypothetical protein | |||
??? | R | hypothetical protein | GTTGCAGGCAATATCCGGCGTAGTGCCGGAATGCGTCAG | PI-AvaI |
4036 | pyridoxamine 5'-phosphate oxidase-like protein |