Ref: Meier,M.J. et al. unpublished

REBASE ref # 28221

Contig set: 3,792,988 bp

GenBank #: QVEJ00000000 (NZ_QVEJ00000000)

REBASE acronym: Bam942

Org_num: 33521

 

All begin D0A23_

Type II
ORF Gene Most similar Specificity Name
 
19230 M M.BveZY1ORF13730P (100% identity) M.Bam942ORF19230P
19235 84 aa hypothetical protein
 
6110 tautomerase family protein
6115 R Bsu13952ORF16390P (100% identity) GGATCC Bam942ORF6125P
6120 C C.Bsu13952ORF16390P (100% identity) ACTTATAGTCTGTAGCCTATAGTC C.Bam942ORF6125P
6125 M M.Bsu13952ORF16390P (100% identity) GGATCC M.Bam942ORF6125P
6130 DUF2573 family protein
 
9260 PTS beta-glucoside transporter subunit EIIBCA
9265 V V.Bsu13952ORF19190P (100% identity) V.Bam942ORF9270P
9270 M M.Bsu13952ORF19190P (100% identity) GCWGC M.Bam942ORF9270P
9275 ATP-binding protein
9280 R BcoB425ORF3138P (100% identity) Bam942ORF9270P
9285 PD-(D/E)XK motif protein
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.