Ref: Wei,Y. et al. unpublished

REBASE ref # 28077

Complete sequence: 4,002,836 bp

GenBank #: CP018902

REBASE acronym: BamHK1

Org_num: 33048

 

All begin BUN12_

Type II
ORF Gene Most similar Specificity Name
 
106 Dephospho-CoA kinase Dephosphocoenzyme A kinase
107 M M.BamFORF921P (100% identity) M.BamHK1ORF107P
108 126 aa hypothetical protein
 
2370 MFS transporter
2371 R Bsu13952ORF16390P (100% identity) GGATCC BamHK1ORF2373P
2372 C C.Bsu13952ORF16390P (100% identity) ACTTATAGTCTGTAGCCTATAGTC C.BamHK1ORF2373P
2373 M M.Bsu13952ORF16390P (100% identity) GGATCC M.BamHK1ORF2373P
2374 81 aa hypothetical protein
 
3001 PTS beta-glucoside transporter subunit IIA
3002 V V.Bsu13952ORF19190P (100% identity) V.BamHK1ORF3003P
3003 M M.Bsu13952ORF19190P (100% identity) GCWGC M.BamHK1ORF3003P
3004 ATP-binding protein
 
3663 249 aa hypothetical protein
3664 M M.BveGFP2ORF12710P (100% identity) M.BamHK1ORF3664P
3665 aspartate phosphatase
 
3778 84 aa hypothetical protein
3779 M M.Bve9912DORF3190P (100% identity) M.BamHK1ORF3779P
3780 107 aa hypothetical protein
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.