Ref: Venkateswaran,K. unpublished

REBASE ref # 24451

Contig set: 3,220,349 bp

GenBank #: NADQ00000000 (NZ_NADQ00000000)

REBASE acronym: Gsp44C

Org_num: 24417

 

All begin B1689_

Type II
ORF Gene Most similar Specificity Name
 
13825 62 aa hypothetical protein
13830 M M.Gto4110ORF3590P (100% identity) TGATCA M.Gsp44CORF13830P
13835 C C.Gto4110ORF3590P (100% identity) ACTTAAAGTCTGTAGACTTATAGC C.Gsp44CORF13830P
??? R Gto4110ORF3590P (100% identity) TGATCA Gsp44CORF13830P
13850 integrase
Type III
ORF Gene Most similar Specificity Name
 
7115 DEAD/DEAH box helicase
7120 M M.Gsp44CORF15165P (88% identity) M.Gsp44CORF7120P
7125 type III restriction endonuclease subunit R
 
7120 site-specific DNA-methyltransferase
7125 R Gsp44CORF15165P (100% identity) Gsp44CORF7125P
7130 deoxyguanosinetriphosphate triphosphohydrolase
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.