Ref: Cho,S.H. unpublished

REBASE ref # 24217

Complete sequence: 4,070,574 bp

GenBank #: CP021505

REBASE acronym: Bam1267

Org_num: 24647

 

All begin S101267_

Type II
ORF Gene Most similar Specificity Name
 
543 249 aa hypothetical protein
544 M M.BveGFP2ORF12710P (100% identity) M.Bam1267ORF544P
545 Response regulator aspartate phosphatase
 
664 84 aa hypothetical protein
665 M M.Bve9912DORF3190P (100% identity) M.Bam1267ORF665P
666 107 aa hypothetical protein
 
989 84 aa hypothetical protein
990 M M.BveC1ORFAP (92% identity) M.Bam1267ORF990P
991 107 aa hypothetical protein
 
1948 33 aa hypothetical protein
1949 M M.BamLL3ORF3374P (100% identity) M.Bam1267ORF1949P
1950 SPBc2 prophage-derived uncharacterized protein
 
2758 107 aa hypothetical protein
2759 M M.BveZY1ORF13730P (100% identity) M.Bam1267ORF2759P
2760 84 aa hypothetical protein
 
3421 MFS-type transporter YusP
3422 R Bsu13952ORF16390P (100% identity) GGATCC Bam1267ORF3424P
3423 C C.Bsu13952ORF16390P (100% identity) ACTTATAGTCTGTAGCCTATAGTC C.Bam1267ORF3424P
3424 M M.Bsu13952ORF16390P (100% identity) GGATCC M.Bam1267ORF3424P
3425 uncharacterized protein
 
4052 Protein-N(pi)-phosphohistidine--sugar
4053 V V.Bsu13952ORF19190P (100% identity) V.Bam1267ORF4054P
4054 M M.Bsu13952ORF19190P (100% identity) GCWGC M.Bam1267ORF4054P
4055 485 aa hypothetical protein
4056 R BcoB425ORF3138P (100% identity) Bam1267ORF4054P
4057 339 aa hypothetical protein
Orphan M
ORF Gene Most similar Specificity Name
 
3197 132 aa hypothetical protein
3198 M M.BamHK1ORF107P (91% identity) M.Bam1267ORF3198P
3199 189 aa hypothetical protein
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.