Ref: Eng,Catherine. unpublished

REBASE ref # 19846

GenBank #: CUWS00000000

REBASE acronym: Bat930029

Org_num: 16296

 

All begin

Type II
ORF Gene Most similar Specificity Name
 
??? M M.Bsu1246ORF146P (96% identity) AGATCT M.Bat930029ORFCP
??? R Bsu1246ORF146P (100% identity) AGATCT Bat930029ORFCP
??? C C.Bsu1246ORF146P (100% identity) ACTTATAGTCCGTGGACACATAGT C.Bat930029ORFCP
 
??? R BatDORFAP (100% identity) GCCNNNNNGGC Bat930029ORFBP
??? M M.Bsu1246ORF130P (94% identity) GCCNNNNNGGC M.Bat930029ORFBP
Type IV
ORF Gene Most similar Specificity Name
 
??? R BatDORFCP (100% identity) Bat930029ORFAP
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.