Ref: Daligault,H.E. et al. Genome Announc 2 (5) (2014)

REBASE ref # 18463

GenBank #: JMTJ00000000

REBASE acronym: Bsu1246

Org_num: 14098

 

All begin DK44_

Type II
ORF Gene Most similar Specificity Name
 
128 rRNA large subunit m3Psi methyltransferase RlmH
129 R BglI (100% identity) GCCNNNNNGGC Bsu1246ORF130P
130 M M.BglI (100% identity) GCCNNNNNGGC M.Bsu1246ORF130P
131 107 aa hypothetical protein
 
145 69 aa hypothetical protein
146 M M.BatSK3ORF10600P (100% identity) AGATCT M.Bsu1246ORF146P
147 R BatSK3ORF10600P (100% identity) AGATCT Bsu1246ORF146P
148 C C.BglII (100% identity) ACTTATAGTCCGTGGACACATAGT C.Bsu1246ORF146P
149 56 aa hypothetical protein
Type IV
ORF Gene Most similar Specificity Name
 
218 mutator mutT family protein
217 R BglORF130P (100% identity) Bsu1246ORF217P
219 eamA-like transporter family protein
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.