Ref: Bishop-Lilly,K.A. et al. unpublished

REBASE ref # 18070

Complete sequence: 4,175,060 bp

GenBank #: CP007640

REBASE acronym: BatBSS

Org_num: 13618

 

All begin DJ95_

Type II
ORF Gene Most similar Specificity Name
 
3482 56 aa hypothetical protein
3483 C C.Bsu1246ORF146P (100% identity) ACTTATAGTCCGTGGACACATAGT C.BatBSSORF3485P
3484 R Bsu1246ORF146P (100% identity) AGATCT BatBSSORF3485P
3485 M M.Bsu1246ORF146P (100% identity) AGATCT M.BatBSSORF3485P
3486 69 aa hypothetical protein
 
3500 107 aa hypothetical protein
3501 M M.Bsu1246ORF130P (100% identity) GCCNNNNNGGC M.BatBSSORF3501P
3502 R Bsu1246ORF130P (100% identity) GCCNNNNNGGC BatBSSORF3501P
3503 rRNA large subunit m3Psi methyltransferase RlmH
Type IV
ORF Gene Most similar Specificity Name
 
3411 eamA-like transporter family protein
3413 R Bsu1246ORF217P (100% identity) BatBSSORF3413P
3412 mutator mutT family protein
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.