Ref: Cole,S.T. et al. Nature 409 (6823), 1007-1011 (2001)

REBASE ref # 6698

Complete sequence: 3,268,203 bp

GenBank #: AL450380 (NC_002677)

REBASE acronym: MleS

Org_num: 3185

 

All begin ML

Type I
ORF Gene Most similar Specificity Name
 
1514 mycobacteriophage protein
1515 S S.MleK2ORF1516P (100% identity) S.MleSORF1516P
1516 M M.MleK2ORF1516P (99% identity) M.MleSORF1516P
1517 93 aa hypothetical protein
Type II
ORF Gene Most similar Specificity Name
 
755 86 aa hypothetical protein
756 M M.MleK2ORF756P (100% identity) M.MleSORF756P
757 230 aa hypothetical protein
Homing
ORF Gene Most similar Specificity Name
 
986 67 aa conserved hypothetical protein
??? R hypothetical protein AGAAGATTGGGGTGATGATGTTCGGGTCTCCCGAAAC PI-MleSI
988 regulatory protein RecX
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.