Ref: Liu,F. et al. J. Bacteriol. 194 (16), 4454 (2012)

REBASE ref # 14771

GenBank #: AJRJ00000000

REBASE acronym: BatC89

Org_num: 9242

 

All begin UY9_

Type II
ORF Gene Most similar Specificity Name
 
6645 rRNA large subunit methyltransferase
6650 R Bsu1246ORF130P (99% identity) GCCNNNNNGGC BatC89ORF6655P
6655 M M.Bsu1246ORF130P (100% identity) GCCNNNNNGGC M.BatC89ORF6655P
6660 107 aa hypothetical protein
 
6725 69 aa hypothetical protein
6730 M M.Bsu1246ORF146P (100% identity) AGATCT M.BatC89ORF6730P
6735 R Bsu1246ORF146P (100% identity) AGATCT BatC89ORF6730P
6740 C C.Bsu1246ORF146P (100% identity) ACTTATAGTCCGTGGACACATAGT C.BatC89ORF6730P
6745 resolvase domain-containing protein
Type IV
ORF Gene Most similar Specificity Name
 
7115 129 aa hypothetical protein
7120 R Bsu1246ORF217P (100% identity) BatC89ORF7120P
7125 285 aa hypothetical protein
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.