Sequence name: chromosome

GenBank: BA000019 (6,413,771 bp)

 

Type Gene Name Predicted
Rec Seq
Contig Coordinates
 
I M M.AvaORF499P 595610-597223
 
I R AvaORF509P 602481-605130
 
I R AvaORF2688P 3276293-3276832 c
I S S.AvaORF2688P 3277624-3278907 c
I M M.AvaORF2688P 3278898-3281312 c
 
I R AvaXIP TAAGNNNNNNNGTCA 4191316-4193646
I M M.AvaXI TAAGNNNNNNNGTCA 4194672-4196114
I S S.AvaXI TAAGNNNNNNNGTCA 4196104-4197731
 
I R AvaORF3620P 4368583-4370913
I M M.AvaORF3620P 4371939-4373393
I S S.AvaORF3620AP 4374063-4374503
I S S.AvaORF3620BP 4375688-4376749
 
I M M.AvaORF4597P 5496270-5497853
I S S.AvaORF4597P 5499577-5500749
I R AvaORF4597P 5501462-5504498
 
II M M.AvaVI GATC 67154-67987 c
 
II R AvaII GGWCC 1085500-1086192
II M M.AvaII GGWCC 1086196-1087629 c
 
II M M.AvaVII GGCC 1356962-1357843
 
II M M.AvaX SAGCTS 1533026-1533628 c
 
II M M.AvaVIII CGATCG 2738971-2740266
 
II R AvaI CYCGRG 4381849-4382796 c
II M M.AvaI CYCGRG 4382796-4384244 c
 
II M M.AvaORF3700P CTGCAG 4468308-4469018
II R AvaORF3700P CTGCAG 4469152-4470792
 
II M M.AvaIX RCCGGY 5020877-5022034
 
II R AvaIII ATGCAT 5284691-5285836 c
II M M.AvaIII ATGCAT 5285817-5286704 c
 
II M M.AvaIVP GCTNAGC 5733911-5735155
II R AvaIVAP GCTNAGC 5735128-5735454
II R AvaIVBP GCTNAGC 5736457-5737017
 
Homing R PI-AvaI GTTGCAGGCAATATCCGGCGTAGTGCCGGAATGCGTCAG 4860196-4862889 c

 

Sequence name: plasmid pCC7120alpha

GenBank: BA000020 (408,101 bp)

 

Type Gene Name Predicted
Rec Seq
Contig Coordinates
 
II M M.AvaORF7270P YGGCCR 284941-285657 c
 
II M M.AvaV GATC 292955-293587 c
 
II M M.AvaORF7369P YGGCCR 393421-394182 c
 
IV R AvaMrrP 136220-137137