Ref: Zhao,X. unpublished

REBASE ref # 26760

Complete sequence: 4,006,790 bp

GenBank #: CP054415

REBASE acronym: Bam205

Org_num: 40338

 

All begin HTY60_

Type II
ORF Gene Most similar Specificity Name
 
2675 249 aa hypothetical protein
2680 M M.BveGFP2ORF12710P (100% identity) M.Bam205ORF2680P
2685 tetratricopeptide repeat protein
 
3265 84 aa hypothetical protein
3270 M M.Bve9912DORF3190P (100% identity) M.Bam205ORF3270P
3275 107 aa hypothetical protein
 
16650 MFS transporter
16655 R Bsu13952ORF16390P (100% identity) GGATCC Bam205ORF16665P
16660 C C.Bsu13952ORF16390P (100% identity) ACTTATAGTCTGTAGCCTATAGTC C.Bam205ORF16665P
16665 M M.Bsu13952ORF16390P (100% identity) GGATCC M.Bam205ORF16665P
16670 YusU family protein
 
19770 PTS glucose transporter subunit IIA
19775 V V.Bsu13952ORF19190P (100% identity) V.Bam205ORF19780P
19780 M M.Bsu13952ORF19190P (100% identity) GCWGC M.Bam205ORF19780P
19785 ATP-binding protein
Orphan M
ORF Gene Most similar Specificity Name
 
5225 dephospho-CoA kinase
5230 M M.BamHK1ORF107P (77% identity) M.Bam205ORF5230P
5235 129 aa hypothetical protein
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.