Ref: Fomenkov,A. et al. unpublished

REBASE ref # 29753

Complete sequence: 3,954,391 bp

GenBank #: CP041693

REBASE acronym: BamH

Org_num: 208

 

All begin FOG69_

Type II
ORF Gene Most similar Specificity Name
 
10015 72 aa hypothetical protein
10020 M M.Bsu13952ORF10440P (98% identity) GGCC M.BamHORF10020P
10025 80 aa hypothetical protein
 
15990 tautomerase family protein
15995 R Bsu13952ORF16390P (100% identity) GGATCC BamHI
16000 C C.Bsu13952ORF16390P (100% identity) ACTTATAGTCTGTAGCCTATAGTC C.BamHI
16005 M M.Bsu13952ORF16390P (100% identity) GGATCC M.BamHI
16010 DUF2573 family protein
 
19145 PTS beta-glucoside transporter subunit EIIBCA
19150 V V.Bsu13952ORF19190P (100% identity) V.BamHIIIP
19155 M M.Bsu13952ORF19190P (100% identity) GCWGC M.BamHIII
19160 ATP-binding protein
19165 R BcoB425ORF3138P (91% identity) BamHIIIP
19170 endonuclease
Orphan M
ORF Gene Most similar Specificity Name
 
10175 73 aa hypothetical protein
10180 M M.BveSCGB1ORF33P (100% identity) GGATCC M.BamHII
10185 130 aa hypothetical protein
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.