Ref: Gibbons,H.S. et al. unpublished

REBASE ref # 12106

Complete sequence: 4,168,266 bp

GenBank #: CP002207 (NC_014639)

REBASE acronym: Bat1942

Org_num: 6383

 

All begin BATR1942_

Type II
ORF Gene Most similar Specificity Name
 
18070 Resolvase domain protein
18075 C C.Bsu1246ORF146P (100% identity) ACTTATAGTCCGTGGACACATAGT C.Bat1942ORF18085P
18080 R Bsu1246ORF146P (100% identity) AGATCT Bat1942ORF18085P
18085 M M.Bsu1246ORF146P (100% identity) AGATCT M.Bat1942ORF18085P
18090 69 aa hypothetical protein
 
18160 107 aa hypothetical protein
18165 M M.Bsu1246ORF130P (100% identity) GCCNNNNNGGC M.Bat1942ORF18165P
18170 R Bsu1246ORF130P (100% identity) GCCNNNNNGGC Bat1942ORF18165P
18175 rRNA large subunit methyltransferase
Type IV
ORF Gene Most similar Specificity Name
 
17690 58 aa hypothetical protein
17695 R Bsu1246ORF217P (100% identity) Bat1942ORF17695P
17700 129 aa hypothetical protein
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.