Ref: Borriss,R. et al. Int. J. Syst. Evol. Microbiol. (2010) In press

REBASE ref # 12056

Complete sequence: 3,980,199 bp

GenBank #: FN597644 (NC_014551)

REBASE acronym: BamF

Org_num: 207

 

All begin BAMF_

Type II
ORF Gene Most similar Specificity Name
 
561 84 aa hypothetical protein predicted by
562 M M.Bve9912DORF3190P (100% identity) M.BamFORF562P
563 107 aa hypothetical protein predicted by
 
920 Dephospho-CoA kinase Dephosphocoenzyme A kinase
921 M M.BamHK1ORF107P (100% identity) TCGA M.BamFORF921P
922 129 aa hypothetical protein predicted by
 
3130 multidrug-efflux transporter
3131 R Bsu13952ORF16390P (100% identity) GGATCC BamFI
??? C C.Bsu13952ORF16390P (100% identity) ACTTATAGTCTGTAGCCTATAGTC C.BamFIP
3132 M M.Bsu13952ORF16390P (100% identity) GGATCC M.BamFIP
3133 81 aa conserved hypothetical protein
 
3749 phosphotransferase system (PTS)
3750 V V.Bsu13952ORF19190P (100% identity) V.BamFORF3751P
3751 M M.Bsu13952ORF19190P (100% identity) GCWGC M.BamFORF3751P
3752 ATP-binding protein
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.