Ref: Morgan,R.D. unpublished

REBASE ref # 1592

Complete sequence: 4,175,482 bp

GenBank #: CP014840

REBASE acronym: Bgl

Org_num: 283

 

All begin A1D11_

Type II
ORF Gene Most similar Specificity Name
 
20180 23S rRNA
20185 R Bsu1246ORF130P (100% identity) GCCNNNNNGGC BglI
20190 M M.Bsu1246ORF130P (100% identity) GCCNNNNNGGC M.BglI
20195 107 aa hypothetical protein
 
20250 69 aa hypothetical protein
20255 M M.Bsu1246ORF146P (99% identity) AGATCT M.BglII
20260 R Bsu1246ORF146P (99% identity) AGATCT BglII
20265 C C.Bsu1246ORF146P (100% identity) ACTTATAGTCCGTGGACACATAGT C.BglII
20270 resolvase
Type IV
ORF Gene Most similar Specificity Name
 
125 DNA mismatch repair protein MutT
130 R Bsu1246ORF217P (100% identity) BglORF130P
135 transporter
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.