Ref: Hazbon,M.H. et al. unpublished

REBASE ref # 18960

Complete sequence: 4,174,830 bp

GenBank #: CP010778

REBASE acronym: Bat1221

Org_num: 14724

 

All begin TD68_

Type II
ORF Gene Most similar Specificity Name
 
16950 resolvase
16955 C C.Bsu1246ORF146P (100% identity) ACTTATAGTCCGTGGACACATAGT C.Bat1221ORF16965P
16960 R Bsu1246ORF146P (100% identity) AGATCT Bat1221ORF16965P
16965 M M.Bsu1246ORF146P (100% identity) AGATCT M.Bat1221ORF16965P
16970 69 aa hypothetical protein
 
17025 107 aa hypothetical protein
17030 M M.Bsu1246ORF130P (100% identity) GCCNNNNNGGC M.Bat1221ORF17030P
17035 R Bsu1246ORF130P (100% identity) GCCNNNNNGGC Bat1221ORF17030P
17040 50S rRNA methyltransferase
Type IV
ORF Gene Most similar Specificity Name
 
16585 transporter
16590 R Bsu1246ORF217P (100% identity) Bat1221ORF16590P
16595 DNA mismatch repair protein MutT
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.