Ref: Yang,H.L. et al. unpublished

REBASE ref # 13484

Complete sequence: 3,939,203 bp

GenBank #: CP002927

REBASE acronym: BamXH7

Org_num: 7545

 

All begin BAXH7_

Type II
ORF Gene Most similar Specificity Name
 
1340 130 aa hypothetical protein
1341 M M.BveSCGB1ORF33P (100% identity) GGATCC M.BamXH7ORF1341P
1342 54 aa hypothetical protein
 
1371 57 aa hypothetical protein
1372 M M.Bsu13952ORF10440P (100% identity) GGCC M.BamXH7ORF1372P
1373 nucleic acid binding protein; phage
 
3399 multidrug-efflux transporter
3400 R Bsu13952ORF16390P (100% identity) GGATCC BamXH7ORF3402P
3401 BamHI control element
3402 M M.Bsu13952ORF16390P (100% identity) GGATCC M.BamXH7ORF3402P
3403 81 aa hypothetical protein
 
3400 type-2 restriction enzyme BamHI
3401 C C.Bsu13952ORF16390P (100% identity) ACTTATAGTCTGTAGCCTATAGTC C.BamXH7ORF3401P
3402 modification methylase BamHI
 
4067 phosphotransferase system (PTS)
??? V V.Bsu13952ORF19190P (100% identity) V.BamXH7ORF4070P
4069 42 aa hypothetical protein
4070 M M.BcoB425ORF3140P (100% identity) GCWGC M.BamXH7ORF4070P
4071 type II restriction-modification system
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.